dict.md logo
Results for A in English, page 98
activity duration
activity file
activity files
activity head
activity holiday
Activity intolerance
Activity intolerance | patient
Activity intolerance | patient | Bld-Ser-Plas
Activity intolerance CCC
Activity intolerance risk
Activity intolerance risk | patient
Activity intolerance risk | patient | Bld-Ser-Plas
Activity intolerance risk CCC
Activity intolerance risk:Find:Pt:^Patient:Ord:Observed.CCC
Activity intolerance risk:Finding:Point in time:^Patient:Ordinal:Observed.CCC
Activity intolerance:Find:Pt:^Patient:Ord:Observed.CCC
Activity intolerance:Finding:Point in time:^Patient:Ordinal:Observed.CCC
Activity involving ice and snow NOS
Activity involving other arts and handcrafts
Activity involving other cardiorespiratory exercise
Activity involving other muscle strengthening exercises
Activity involving physical training
Activity involving playing electric musical instrument
Activity involving water NOS
activity level
activity level during leisure activity (___ METs)
activity log
ACTIVITY MOTOR EXAGGERATED
ACTIVITY MOTOR RETARDED
Activity NEC
Activity NEC in ICD9CM
Activity NEC in MTHICD9
activity network
Activity NOS
activity of daily living
activity package
activity point
Activity preferences - cards or other games
Activity preferences - cards or other games | patient
Activity preferences - cards or other games | patient | Bld-Ser-Plas
Activity preferences - cards or other games:Finding:Point in time:^Patient:Ordinal:MDS
Activity preferences - crafts or arts
Activity preferences - crafts or arts | patient
Activity preferences - crafts or arts | patient | Bld-Ser-Plas
Activity preferences - exercise or sports
Activity preferences - exercise or sports | patient
Activity preferences - exercise or sports | patient | Bld-Ser-Plas
Activity preferences - gardening or plants
Activity preferences - gardening or plants | patient
Activity preferences - gardening or plants | patient | Bld-Ser-Plas
Activity preferences - helping others
Activity preferences - helping others | patient
Activity preferences - helping others | patient | Bld-Ser-Plas
Activity preferences - music
Activity preferences - music | patient
Activity preferences - music | patient | Bld-Ser-Plas
Activity preferences - none of above
Activity preferences - none of above | patient
Activity preferences - none of above | patient | Bld-Ser-Plas
Activity preferences - reading or writing
Activity preferences - reading or writing | patient
Activity preferences - reading or writing | patient | Bld-Ser-Plas
Activity preferences - spiritual or religious activities
Activity preferences - spiritual or religious activities | patient
Activity preferences - spiritual or religious activities | patient | Bld-Ser-Plas
Activity preferences - talking or conversing
Activity preferences - talking or conversing | patient
Activity preferences - talking or conversing | patient | Bld-Ser-Plas
Activity preferences - trips or shopping
Activity preferences - trips or shopping | patient
Activity preferences - trips or shopping | patient | Bld-Ser-Plas
Activity preferences - walking or wheeling outdoors
Activity preferences - walking or wheeling outdoors | patient
Activity preferences - walking or wheeling outdoors | patient | Bld-Ser-Plas
Activity preferences - watching TV
Activity preferences - watching TV | patient
Activity preferences - watching TV | patient | Bld-Ser-Plas
Activity pursuit patterns section
Activity pursuit patterns section | patient
Activity pursuit patterns section | patient | Bld-Ser-Plas
Activity pursuit patterns section:-:Point in time:^Patient:-
Activity QAM
activity rate
activity ratio
activity ray
activity rays
Activity Reason
activity regulated cytoskeletal-associated protein
activity request packet
activity sampling
Activity Scale for Kids
activity schedule
activity schedules
Activity Session
Activity Status
activity therapy
Activity therapy, per 15 min
ACTIVITY THERAPY, PER 15 MINUTES
ACTIVITY THERAPY, SUCH AS MUSIC, DANCE, ART OR PLAY THERAPIES NOT FOR RECREATION, RELATED TO THE CARE AND TREATMENT OF PATIENT'S DISABLING MENTAL HEALTH PROBLEMS, PER SESSION (45 MINUTES OR MORE)
activity variance
activity-based costing
activity-based management
activity-dependent neuroprotective protein, mouse
activity-dependent neuroprotective protein, rat
ACTIVITY-DEPENDENT NEUROPROTECTOR HOMEOBOX
activity-dependent neuroprotector protein, human
activity-dependent neurotrophic factor, human
activity-dependent neurotrophic factor, mouse
activity-dependent neurotrophic factor, rat
ACTIVITY-REGULATED CYTOSKELETON-ASSOCIATED PROTEIN
activity-regulated cytoskeleton-associated protein, human
activity-regulated cytoskeleton-associated protein, mouse
activity-regulated cytoskeleton-associated protein, rat
Activity, Blood Bactericidal
Activity, Clinic
Activity, Daily Living
Activity, Diazotrophic
Activity, Distributional
Activity, Educational
Activity, Extravehicular
Activity, Financial
Activity, Glomerular Procoagulant
Activity, Higher Nervous
Activity, Human
Activity, Leisure
Activity, Locomotor
Activity, Motor
Activity, Nonsuppressible Insulin-Like
Activity, Nonsuppressible Insulinlike
Activity, Optical
Activity, Physical
Activity, Political
Activity, Recruitment
Activity, Research
Activity, Sexual
Activity, Solar
Activity:Find:Pt:^Patient:Ord:Observed.QAM
Activity:Find:Pt:Heart^fetus:Nar:US
Activity:Find:Pt:Heart^fetus:Nom:US
Activity:Find:Pt:Limbs^fetus:Nar:US
Activity:Find:Pt:Limbs^fetus:Nom:US
Activity:Find:Pt:Respiratory system^fetus:Nar:US
Activity:Find:Pt:Respiratory system^fetus:Nom:US
Activity:Find:Pt:Trunk^fetus:Nar:US
Activity:Find:Pt:Trunk^fetus:Nom:US
Activity:Finding:Point in time:^Patient:Ordinal:Observed.QAM
Activity:Finding:Point in time:Heart^Fetus:Narrative:ULTRASOUND
Activity:Finding:Point in time:Heart^Fetus:Nominal:ULTRASOUND
Activity:Finding:Point in time:Limbs^Fetus:Narrative:ULTRASOUND
Activity:Finding:Point in time:Limbs^Fetus:Nominal:ULTRASOUND
Activity:Finding:Point in time:Respiratory system^Fetus:Narrative:ULTRASOUND
Activity:Finding:Point in time:Respiratory system^Fetus:Nominal:ULTRASOUND
Activity:Finding:Point in time:Trunk^Fetus:Narrative:ULTRASOUND
Activity:Finding:Point in time:Trunk^Fetus:Nominal:ULTRASOUND
ActivOn Arthritis
ActivOn Arthritis, topical stick
ActivOn Joint & Muscle
ActivOn Joint & Muscle 41.3 MG/ML Topical Cream
ActivOn Joint & Muscle, topical stick
ACTL protein, chicken
ACTL4 gene
ACTL5 gene
Actl6
ACTL6A
ACTL6A gene
ACTL6B
ACTL6B gene
ACTL6B protein, human
ACTL7A
ACTL7A gene
ACTL7A protein, human
Actl7a protein, mouse
ACTL7B
ACTL7B gene
ACTL7B protein, human
Actl7b protein, mouse
ACTL8 gene
ActListCode
ACTM
ActMedicalServiceCode
ActMonitoringProtocolCode
ActMood
ActMood - CodeSystem
ActMoodCompletionTrack
ActMoodPredicate
ACTN1
ACTN1 gene
ACTN1 protein, human
Actn1 protein, mouse
ACTN2
ACTN2 gene
ACTN2 protein, human
Actn2 protein, mouse
Actn2 protein, rat
ACTN2, GLN9ARG
Actn2lp protein, rat
ACTN3
ACTN3 DEFICIENCY
ACTN3 gene
ACTN3 protein, human
ACTN3 protein, mouse
Actn3 protein, rat
ACTN3, ARG577TER
ACTN4
ACTN4 gene
ACTN4 protein, human
Actn4 protein, mouse
Actn4 protein, rat
ACTN4, LYS228GLU
ACTN4, SER235PRO
ACTN4, THR232ILE
Actnc retic actnc grnlma
ActNoImmunizationReason
ACTO S1
actobindin
ActObservationList
actodigin
actodigin genin
Actoheavy Meromyosin
ActoHorm
actolinkin protein, sea urchin
Actomol
Actomyosin
Actomyosin [Chemical/Ingredient]
Actomyosin Adenosinetriphosphatase
actomyosin apparatus assembly involved in cytokinesis
actomyosin ATPase
actomyosin complex
actomyosin complex location
actomyosin contractile ring
actomyosin location
actomyosin organization
actomyosin ring
actomyosin ring (sensu Fungi)
actomyosin ring (sensu Saccharomyces)
actomyosin ring positioning
actomyosin structure
actomyosin structure organisation and biogenesis
actomyosin structure organization
actomyosin structure organization and biogenesis>
Actomyosin Subfragment 1 ATPase
Actomyosin Subfragments
actomyosin, actin part
actomyosin, myosin complex location part
actomyosin, myosin complex part
Actomyosins
actone oxime
Actonel
Actonel 150 MG Oral Tablet
Actonel 30 MG Oral Tablet
Actonel 35 12-Week Once Weekly Dosepack
Actonel 35 4-Week Once Weekly Dosepack
Actonel 35 MG Oral Tablet
Actonel 35 Once Weekly Dosepack
Actonel 35mg Tablet includes 4 & 12-Week Once Weekly Dosepack
Actonel 5 MG Oral Tablet
Actonel 75 Dosepack
Actonel 75 MG Oral Tablet
Actonel brand of risedronate sodium
Actonel brand of risedronate sodium 35 MG Oral Tablet
Actonel geographic location
Actonel One Month Dose Pack
Actonel with Calcium
Actonel with Calcium 28 Day Pack
ACTONEL WITH CALCIUM KIT
ACTONEL WITH CALCIUM TABLETS KIT 35 MG/500 MG
Actonel with Calcium, 1250 mg-35 mg oral kit
Actonel with Calcium, 1250 mg-35 mg oral tablet
Actonel, 150 mg oral tablet
Actonel, 30 mg oral tablet
Actonel, 35 mg oral tablet
Actonel, 35 mg oral tablet_#1
Actonel, 35 mg oral tablet_#2
Actonel, 5 mg oral tablet
Actonel, 75 mg oral tablet
actons
actopaxin protein, rat
Actophilornis
Actophilornis africanus
actophorin
actophorin protein, Acanthamoeba
Actoplus Met
Actoplus Met 15/1000
Actoplus Met 15/500
Actoplus Met 15/500 MG Oral Tablet
Actoplus Met 15/850
Actoplus Met 15/850 MG Oral Tablet
Actoplus Met 30/1000
Actoplus Met XR 15/1000 Extended Release Tablet
Actoplus Met XR 30/1000 Extended Release Tablet
Actoplus Met, 500 mg-15 mg oral tablet
Actoplus Met, 850 mg-15 mg oral tablet
actor
actor-director
ActOrderCode
Actornithophilus
Actornithophilus ceruleus
Actornithophilus erinaceus
Actornithophilus piceus
actors
Actorthia
Actorthia micans
Actos
Actos 15 MG Oral Tablet
Actos 30 MG Oral Tablet
Actos 45 MG Oral Tablet
Actos, 15 mg oral tablet
Actos, 30 mg oral tablet
Actos, 45 mg oral tablet
actosin P
actosubfragment 1
Actovegin
ACTP
ActPatientTransportationModeCode
ActPaymentCode
ActPharmacySupplyType
ActPriority
ActPriority - CodeSystem
ActPrivilegeCategorization
ActPrivilegeCategorizationType
ActProcedureCode
ActProductAcquisitionCode
ACTR
ACTR protein, human
ActR-I protein, human
ActR-I protein, mouse
ActR-IA protein, human
ACTR-IB
ActR-IB protein, human
ActR-IB protein, mouse
ACTR-II
ACTR-II A
ACTR-IIB
ActR-IIB protein, human
ACTR10 gene
ACTR11
Actr13E protein, Drosophila
ACTR1A
ACTR1A gene
Actr1a protein, mouse
ACTR1B
ACTR1B gene
ACTR2
ACTR2 gene
ACTR2 Protein
ACTR2 protein, human
Actr2 protein, mouse
ACTR3
ACTR3 gene
ACTR3 Protein
ACTR3 protein, human
Actr3 protein, mouse
ACTR3B gene
ACTR3P1 gene
ACTR5 gene
Actr53D protein, Drosophila
ACTR6 gene
ACTR6 protein, human
actr66B protein, Drosophila
ACTR8 gene
Actr87C protein, Drosophila
Actrapid insulin
ActReason
ActReason - CodeSystem
ActRegistryCode
ActRelationshipAccounting
ActRelationshipCheckpoint
ActRelationshipCheckpoint - CodeSystem
ActRelationshipConditional
ActRelationshipCostTracking
ActRelationshipExpectedSubset
ActRelationshipJoin
ActRelationshipJoin - CodeSystem
ActRelationshipPastSubset
ActRelationshipPosting
ActRelationshipSplit
ActRelationshipSplit - CodeSystem
ActRelationshipSubset
ActRelationshipSubset - CodeSystem
ActRelationshipSubset - minimum
ActRelationshipType
ActRelationshipType - CodeSystem
actress
actresses
ACTRI
Actri 1
Actri 2
ActRIB
ACTRII
ACTRII protein, human
ACTRIIA
ACTRIIB
ActRIIB protein, mouse
Actron
Actron 12.5 MG Oral Tablet
Actron, 12.5 mg oral tablet
ACTRP
ACTRT1
ACTRT1 gene
ACTRT1 protein, human
Actrt1 protein, mouse
ACTRT2
ACTRT2 gene
acts
Acts as a patient advocate by protecting the patient from incompetent, unethical, or illegal practices.
acts of desperation
acts of god excepted
acts of reprisal
acts of revenge
acts of state
acts of terrorism
Acts of the Apostles
acts of violence
acts of volition
acts of war
Acts, HITECH
Acts, M-HITECH
ACTSA
ACTSG
ActSite
ActSpecimenTreatmentCode
ActSpecObsArtBldCode
ActSpecObsArtBldCode - ActCode
ActSpecObsCode
ActSpecObsDilutionCode
ActSpecObsDilutionCode - ActCode
ActSpecObsEvntfctsCode
ActSpecObsEvntfctsCode - ActCode
ActSpecObsInterferenceCode
ActSpecObsInterferenceCode - ActCode
ActSpecObsVolumeCode
ActSpecObsVolumeCode - ActCode
ActStatus
ActStatus - active
ActStatus - CodeSystem
ActSubstanceAdministrationCode
ActSubstanceAdminSubstitutionCode
ActSuppliedItemDetectedIssueCode
ActSupplyFulfillmentRefusalReason
ACTT-acyltransferase
ActTherapyDurationWorkingListCode
ActTransportationModeCode
ACTTTCGTTTTCTGCGTCAA
Actua lLow Family Support
Actual
Actual Ability To Adjust
Actual Ability To Perform Health Maintenance
Actual Ability To Perform Leisure Activity
Actual Acceptance Of Health Status
Actual Accrual
Actual Accrual for Clinical Trial
Actual Accrual Number
Actual Activity Intolerance
Actual Acute Confusion
actual address
actual address key
Actual Adequate Hydration
Actual Adherence
Actual Adherence To Diagnostic Testing
Actual Adherence To Dietary Regime
Actual Adherence To Exercise Regime
Actual Adherence To Fluid Volume
Actual Adherence To Medication Regime
Actual Adherence To Safety Precautions
Actual Adherence To Therapeutic Regime
Actual Adult Negative Ability To Thrive
Actual Agitation
Actual Alcohol Abuse
Actual Altered Blood Pressure
actual amount
actual amounts
Actual Aspiration
actual attainment
actual authority
actual balance
Actual blood loss
actual capacity
actual cash value
actual cata
actual clearance
actual code
Actual Communication Barrier
Actual Complex Medication Regime
Actual Complex Treatment Regime
Actual Conflicting (Negative) Cultural Beliefs
Actual Conflicting (Negative) Family Attitude
Actual Conflicting Attitude Toward Care
Actual Conflicting Attitude Toward Dietary Regime
Actual Conflicting Attitude Toward Exercise
Actual Conflicting Attitude Toward Medication Management
Actual Conflicting Attitude Toward Therapeutic Regime
Actual Conflicting Health Belief
Actual Conflicting Religious Belief
Actual Conflicting Spiritual Belief
Actual Contamination Exposure
actual cost
actual cost of work performed
actual cost system
Actual count
Actual Crime Act
96 97 98 99 100