dict.md logo
Results for D in English, page 244
DNA-Repair Protein Complementing XP-G Cells
DNA-Repair Protein XPD
DNA-Sephadex
DNA-Sephadex G-25
DNA-specific endonuclease (xeroderma pigmentosum)
DNA-spermidine
DNA-T replication protein, E coli
DNA-TP-phage PRD1
DNA-uptake-stimulating protein, Neurospora
DNA, A Form
DNA, A-Form
DNA, A-Form [Chemical/Ingredient]
DNA, Algal
DNA, Algal [Chemical/Ingredient]
DNA, Anti-Sense
DNA, Antisense
DNA, Antisense [Chemical/Ingredient]
DNA, Archaeal
DNA, Archaeal [Chemical/Ingredient]
DNA, B Form
DNA, B-Form
DNA, Bacterial
DNA, Bacterial [Chemical/Ingredient]
DNA, C Form
DNA, C-Form
DNA, C-Form [Chemical/Ingredient]
DNA, calf thymus
DNA, Catalytic
DNA, Catalytic [Chemical/Ingredient]
DNA, Catanates
DNA, Catenated
DNA, Catenated [Chemical/Ingredient]
DNA, Chloroplast
DNA, Chloroplast [Chemical/Ingredient]
DNA, Circular
DNA, Circular [Chemical/Ingredient]
DNA, Complementary
DNA, Complementary [Chemical/Ingredient]
DNA, Concatemers
DNA, Concatenated
DNA, Concatenated [Chemical/Ingredient]
DNA, Cruciform
DNA, Cruciform [Chemical/Ingredient]
DNA, CYTOPLASMIC-MEMBRANE
DNA, d(P-thio)(G-T-T-C-T-C-G-C-T-G-G-T-G-A-G-T-T-T-C-A)
DNA, d(P-thio)(GTTCTCGCTGGTGAGTTTCA)
DNA, Double Stranded
DNA, Double-Stranded
DNA, Fungal
DNA, Fungal [Chemical/Ingredient]
DNA, glucosylated
DNA, Helminth
DNA, Helminth [Chemical/Ingredient]
DNA, Heteroduplex
DNA, Holliday Junction
DNA, Intergenic
DNA, Intergenic [Chemical/Ingredient]
DNA, Junk
DNA, Kinetoplast
DNA, Kinetoplast [Chemical/Ingredient]
DNA, Left-Handed
DNA, LOW-REPETITIVE SEQUENCES OF
DNA, Mitochondrial
DNA, Mitochondrial [Chemical/Ingredient]
DNA, Neoplasm
DNA, Neoplasm [Chemical/Ingredient]
DNA, Plant
DNA, Plant [Chemical/Ingredient]
DNA, Protozoan
DNA, Protozoan [Chemical/Ingredient]
DNA, Quadruplex
DNA, Recombinant
DNA, Recombinant [Chemical/Ingredient]
DNA, Ribosomal
DNA, Ribosomal [Chemical/Ingredient]
DNA, Ribosomal Spacer
DNA, Ribosomal Spacer [Chemical/Ingredient]
DNA, Satellite
DNA, Satellite [Chemical/Ingredient]
DNA, Satellite I
DNA, SATELLITE, ALPHA TYPE
DNA, SATELLITE, III
DNA, Selfish
DNA, Single Stranded
DNA, Single-Stranded
DNA, Single-Stranded [Chemical/Ingredient]
DNA, Spacer
DNA, Supercoiled
DNA, Superhelical
DNA, Superhelical [Chemical/Ingredient]
DNA, Supertwisted
DNA, Tetraplex
DNA, triplex
DNA, Viral
DNA, Viral [Chemical/Ingredient]
DNA, Z Form
DNA, Z-Form
DNA, Z-Form [Chemical/Ingredient]
DNA:Type:Pt:XXX:Nom:RFLP probe
DNA'sequencing Shared Resource
DNA(hypoxanthine) glycohydrolase
DNA(hypoxanthine) glycohydrolase activity
DNA[cytosine-N4]methyltransferase activity
DNA/RNA helicase activity
DNA#en|DNA
DNA19 protein, S cerevisiae
DNA2
DNA2 DNA replication helicase 2-like (yeast) protein, human
DNA2 gene
Dna2 protein, C elegans
DNA2 protein, human
DNA2 protein, S cerevisiae
Dna2 protein, S pombe
DNA2 protein, Xenopus
DNA2-LIKE
DNA2-like helicase, human
DNA26 protein, S cerevisiae
DNA2L
DNA2L protein, human
DNA43
DNA43 protein, S cerevisiae
DNA52 protein, S cerevisiae
DnaA protein, Bacteria
DnaA protein, E coli
dnaA5 protein, Bacteria
dNAAglucagon-NH2
DNAAMP
DNAase
DNAase activity
DNAase I
DNAase II
DnaB Helicase
DnaB helicase, E coli
DnaB Helicases
DnaB Helicases [Chemical/Ingredient]
dNAB protein, Drosophila
dnaB protein, E coli
DNABF
DnaC protein, E coli
dNaCh
Dnacin
dnacin A1
dnacin B1
dnacins
DnaD protein, Bacillus subtilis
DnaE protein
DnaE protein, E coli
DnaG (Primase)
DnaG Gene Product
DnaG Protein
dnaG protein, E coli
DNAH1
DNAH1 gene
DNAH10
DNAH10 gene
DNAH11
DNAH11 gene
DNAH11 protein, human
DNAH11, 57-BP DEL, NT13552
DNAH11, ARG2852TER
DNAH11, TYR4128TER
DNAH12
DNAH12 gene
DNAH12 protein, human
DNAH13 gene
DNAH14
DNAH14 gene
DNAH17
DNAH17 gene
DNAH17 protein, human
DNAH17L
DNAH17L protein, human
DNAH2
DNAH2 gene
DNAH3
DNAH3 gene
Dnah3 protein, mouse
DNAH5
DNAH5 gene
DNAH5 protein, human
DNAH5, 1-BP INS, 5130A
DNAH5, 1-BP INS, 5563A
DNAH5, GLN610TER
DNAH5, GLY3519ARG
DNAH5, IVS74AS, G-C, -1
DNAH6
DNAH6 gene
DNAH7
DNAH7 gene
DNAH8
DNAH8 gene
DNAH9
DNAH9 gene
DNAH9 protein, human
DNAHBL
DNAHC1
DNAHC11
Dnahc11 protein, mouse
dnahc11 protein, zebrafish
Dnahc14
DNAHC2
DNAHC3
DNAHC3B
Dnahc5
Dnahc6
Dnahc8 protein, mouse
Dnahc9
DnaI protein, Bacillus subtilis
DNAI1
DNAI1 gene
DNAI1 protein, human
DNAI1, 12-BP DEL
DNAI1, 4-BP INS, CODON 95
DNAI1, GLY515SER
DNAI1, IVS1DS, 1-BP INS, +3T
DNAI1+DNAH5 gene
DNAI1+DNAH5 gene | Blood or Tissue
DNAI1+DNAH5 gene Mut Anal Bld/T
DNAI1+DNAH5 gene mutation analysis
DNAI1+DNAH5 gene mutation analysis:Presence or Identity:Point in time:Whole blood/Tissue, unspecified:Nominal:MOLECULAR GENETICS
DNAI1+DNAH5 gene mutation analysis:Prid:Pt:Bld/Tiss:Nom:Molgen
DNAI1+DNAH5 gene mutations found [Identifier] in Blood or Tissue by Molecular genetics method Nominal
DNAI2
DNAI2 gene
DNAI2, ARG263TER
DNAI2, IVS11DS, G-A, +1
DNAI2, IVS3AS, T-G, -3
Dnaic2 protein, mouse
DNAJ
DnaJ (Hsp40) homolog, subfamily A member protein, zebrafish
DnaJ (Hsp40) homolog, subfamily A, member 1
DnaJ (Hsp40) homolog, subfamily A, member 1 protein, human
DnaJ (Hsp40) homolog, subfamily A, member 1 protein, mouse
DnaJ (Hsp40) homolog, subfamily A, member 2
DnaJ (Hsp40) homolog, subfamily A, member 2 protein, human
DnaJ (Hsp40) homolog, subfamily A, member 3
DnaJ (Hsp40) homolog, subfamily A, member 3 protein, human
DnaJ (Hsp40) homolog, subfamily A, member 3 protein, mouse
DnaJ (Hsp40) homolog, subfamily A, member 4
DnaJ (Hsp40) homolog, subfamily A, member 4 protein, human
DnaJ (Hsp40) homolog, subfamily A, member 4 protein, mouse
DnaJ (Hsp40) homolog, subfamily B, member 1
DnaJ (Hsp40) homolog, subfamily B, member 1 protein, mouse
DnaJ (Hsp40) homolog, subfamily B, member 1 pseudogene
DnaJ (Hsp40) homolog, subfamily B, member 1, human
DnaJ (Hsp40) homolog, subfamily B, member 11
DnaJ (Hsp40) homolog, subfamily B, member 11, human
DnaJ (Hsp40) homolog, subfamily B, member 12
DnaJ (Hsp40) homolog, subfamily B, member 12 protein, human
DnaJ (Hsp40) homolog, subfamily B, member 14
DnaJ (Hsp40) homolog, subfamily B, member 2
DnaJ (Hsp40) homolog, subfamily B, member 2 protein, human
DnaJ (Hsp40) homolog, subfamily B, member 3
DnaJ (Hsp40) homolog, subfamily B, member 3, mouse
DnaJ (Hsp40) homolog, subfamily B, member 4
DnaJ (Hsp40) homolog, subfamily B, member 4, human
DnaJ (Hsp40) homolog, subfamily B, member 5
DnaJ (Hsp40) homolog, subfamily B, member 5 protein, human
DnaJ (Hsp40) homolog, subfamily B, member 5 protein, mouse
DnaJ (Hsp40) homolog, subfamily B, member 6
DnaJ (Hsp40) homolog, subfamily B, member 6 protein, human
DnaJ (Hsp40) homolog, subfamily B, member 6 protein, mouse
DnaJ (Hsp40) homolog, subfamily B, member 7
DnaJ (Hsp40) homolog, subfamily B, member 8
DnaJ (Hsp40) homolog, subfamily B, member 9
DnaJ (Hsp40) homolog, subfamily B, member 9 protein, human
DnaJ (Hsp40) homolog, subfamily C, member 1
DnaJ (Hsp40) homolog, subfamily C, member 1 protein, human
DnaJ (Hsp40) homolog, subfamily C, member 1 protein, mouse
DnaJ (Hsp40) homolog, subfamily C, member 10
DnaJ (Hsp40) homolog, subfamily C, member 10 protein, human
DnaJ (Hsp40) homolog, subfamily C, member 11
DnaJ (Hsp40) homolog, subfamily C, member 11 protein, human
DnaJ (Hsp40) homolog, subfamily C, member 12
DnaJ (Hsp40) homolog, subfamily C, member 13
DnaJ (Hsp40) homolog, subfamily C, member 13, human
DnaJ (Hsp40) homolog, subfamily C, member 14
DnaJ (Hsp40) homolog, subfamily C, member 14 protein, human
DnaJ (Hsp40) homolog, subfamily C, member 15
DnaJ (Hsp40) homolog, subfamily C, member 15 protein, human
DnaJ (Hsp40) homolog, subfamily C, member 16
DnaJ (Hsp40) homolog, subfamily C, member 17
DnaJ (Hsp40) homolog, subfamily C, member 18
DnaJ (Hsp40) homolog, subfamily C, member 19
DnaJ (Hsp40) homolog, subfamily C, member 19 protein, human
DnaJ (Hsp40) homolog, subfamily C, member 2
DnaJ (Hsp40) homolog, subfamily C, member 2 protein, mouse
DnaJ (Hsp40) homolog, subfamily C, member 20
DnaJ (Hsp40) homolog, subfamily C, member 21
DnaJ (Hsp40) homolog, subfamily C, member 22
DnaJ (Hsp40) homolog, subfamily C, member 24
DnaJ (Hsp40) homolog, subfamily C, member 25
DnaJ (Hsp40) homolog, subfamily C, member 27
DnaJ (Hsp40) homolog, subfamily C, member 28
DnaJ (Hsp40) homolog, subfamily C, member 3
DnaJ (Hsp40) homolog, subfamily C, member 3 protein, human
DnaJ (Hsp40) homolog, subfamily C, member 3 protein, mouse
DnaJ (Hsp40) homolog, subfamily C, member 30
DnaJ (Hsp40) homolog, subfamily C, member 4
DnaJ (Hsp40) homolog, subfamily C, member 4, human
DnaJ (Hsp40) homolog, subfamily C, member 5
DnaJ (Hsp40) homolog, subfamily C, member 5 beta
DnaJ (Hsp40) homolog, subfamily C, member 5 gamma
DnaJ (Hsp40) homolog, subfamily C, member 5 protein, human
DnaJ (Hsp40) homolog, subfamily C, member 6
DnaJ (Hsp40) homolog, subfamily C, member 6 protein, human
DnaJ (Hsp40) homolog, subfamily C, member 7
DnaJ (Hsp40) homolog, subfamily C, member 7 protein, human
DnaJ (Hsp40) homolog, subfamily C, member 7 protein, mouse
DnaJ (Hsp40) homolog, subfamily C, member 8
DnaJ (Hsp40) homolog, subfamily C, member 8 protein, human
DnaJ (Hsp40) homolog, subfamily C, member 8 pseudogene 1
DnaJ (Hsp40) homolog, subfamily C, member 9
DnaJ (Hsp40) homolog, subfamily C, member 9 protein, human
DnaJ (Hsp40) related, subfamily B, member 13
DnaJ (Hsp40) related, subfamily B, member 13 protein, human
DNAJ 1 protein, leek
DnaJ homolog AtJ1 protein, Arabidopsis
DnaJ homolog subfamily A member 2, rat
DnaJ Homolog Subfamily B Member 4 Gene
DnaJ Homolog Subfamily B Member 4 Protein
DnaJ Homolog Subfamily B Member 4 wt Allele
DnaJ homolog subfamily C member 1 protein, human
DnaJ protein homolog ATJ2, Arabidopsis
DnaJ protein, Allium porrum
DnaJ protein, E coli
DnaJ Proteins
DnaJ-1 protein, Drosophila
DNAJ-like 2 protein, human
DNAJ-like 4 protein, mouse
DnaJ-like-1 protein, Drosophila
DnaJ-related protein SCJ1, S cerevisiae
DNAJ/HSP40 HOMOLOG, SUBFAMILY A, MEMBER 1
DNAJ/HSP40 HOMOLOG, SUBFAMILY A, MEMBER 2
DNAJ/HSP40 HOMOLOG, SUBFAMILY A, MEMBER 3
DNAJ/HSP40 HOMOLOG, SUBFAMILY B, MEMBER 1
DNAJ/HSP40 HOMOLOG, SUBFAMILY B, MEMBER 11
DNAJ/HSP40 HOMOLOG, SUBFAMILY B, MEMBER 12
DNAJ/HSP40 HOMOLOG, SUBFAMILY B, MEMBER 13
DNAJ/HSP40 HOMOLOG, SUBFAMILY B, MEMBER 2
DNAJ/HSP40 HOMOLOG, SUBFAMILY B, MEMBER 4
DNAJ/HSP40 HOMOLOG, SUBFAMILY B, MEMBER 5
DNAJ/HSP40 HOMOLOG, SUBFAMILY B, MEMBER 6
DNAJ/HSP40 HOMOLOG, SUBFAMILY B, MEMBER 7
DNAJ/HSP40 HOMOLOG, SUBFAMILY B, MEMBER 8
DNAJ/HSP40 HOMOLOG, SUBFAMILY B, MEMBER 9
DNAJ/HSP40 HOMOLOG, SUBFAMILY C, MEMBER 1
DNAJ/HSP40 HOMOLOG, SUBFAMILY C, MEMBER 10
DNAJ/HSP40 HOMOLOG, SUBFAMILY C, MEMBER 12
DNAJ/HSP40 HOMOLOG, SUBFAMILY C, MEMBER 14
DNAJ/HSP40 HOMOLOG, SUBFAMILY C, MEMBER 19
DNAJ/HSP40 HOMOLOG, SUBFAMILY C, MEMBER 3
DNAJ/HSP40 HOMOLOG, SUBFAMILY C, MEMBER 4
DNAJ/HSP40 HOMOLOG, SUBFAMILY C, MEMBER 5
DNAJ/HSP40 HOMOLOG, SUBFAMILY C, MEMBER 6
DNAJ/HSP40 HOMOLOG, SUBFAMILY C, MEMBER 7
DNAJ/HSP40 HOMOLOG, SUBFAMILY C, MEMBER 9
dnaja protein, zebrafish
DNAJA1
DNAJA1 gene
DNAJA1 protein, human
Dnaja1 protein, mouse
DNAJA2
DNAJA2 gene
DNAJA2 protein, human
Dnaja2 protein, rat
DNAJA3
DNAJA3 gene
DNAJA3 protein, human
Dnaja3 protein, mouse
DNAJA4 gene
DNAJA4 protein, human
Dnaja4 protein, mouse
DNAJA5
DNAJB1
DNAJB1 gene
DNAJB1 protein, human
Dnajb1 protein, mouse
DNAJB11
DNAJB11 gene
DNAJB11 protein, human
DNAJB12
DNAJB12 gene
DNAJB12 protein, human
DNAJB13
DNAJB13 gene
DNAJB13 protein, human
DNAJB13 protein, mouse
DNAJB14 gene
DNAJB1P gene
DNAJB2
DNAJB2 gene
DNAJB2 protein, human
DNAJB3 gene
Dnajb3 protein, mouse
DNAJB4
DNAJB4 gene
DNAJB4 protein, human
DNAJB4 wt Allele
DNAJB5
DNAJB5 gene
DNAJB5 protein, human
Dnajb5 protein, mouse
DNAJB6
DNAJB6 gene
DNAJB6 protein, human
Dnajb6 protein, mouse
DNAJB7
DNAJB7 gene
DNAJB8
DNAJB8 gene
DNAJB9
DNAJB9 gene
DNAJB9 protein, human
DNAJC1
DNAJC1 gene
DNAJC1 protein, human
Dnajc1 protein, mouse
DNAJC10
DNAJC10 gene
DNAJC10 protein, human
DNAJC11 gene
DNAJC11 protein, human
DNAJC12
DNAJC12 gene
DNAJC13 gene
DNAJC13 protein, human
DNAJC13 protein, rat
DNAJC14
DNAJC14 gene
DNAJC14 protein, human
DNAJC15 gene
DNAJC15 protein, human
DNAJC16 gene
DNAJC17 gene
DNAJC18 gene
DNAJC19
DNAJC19 gene
DNAJC19 protein, human
DNAJC19, IVS3, G-C, -1
DNAJC2 gene
Dnajc2 protein, mouse
DNAJC20
DNAJC21 gene
DNAJC22 gene
DNAJC24 gene
DNAJC25 gene
DNAJC27 gene
DNAJC28 gene
DNAJC3
DNAJC3 gene
DNAJC3 protein, human
Dnajc3 protein, mouse
DNAJC30 gene
DNAJC4
DNAJC4 gene
DNAJC4 protein, human
DNAJC5
DNAJC5 gene
DNAJC5 protein, human
Dnajc5 protein, rat
DNAJC5A
DNAJC5B gene
DNAJC5G gene
DNAJC6
DNAJC6 gene
DNAJC6 protein, human
DNAJC7
DNAJC7 gene
DNAJC7 protein, human
Dnajc7 protein, mouse
DNAJC8 gene
DNAJC8 protein, human
DNAJC8P1 gene
DNAJC9
DNAJC9 gene
DNAJC9 protein, human
DNAJD1 protein, human
DNAJL1
DNAJL1 protein, human
DNAJW
DnaK protein, Bacillus
DnaK protein, Brevibacillus choshinensis
dnak protein, Chlamydia trachomatis
dnaK protein, E coli
DnaK2 protein, bacteria
DnaK3 protein, Synechococcus
DNAL1
DNAL1 gene
DNAL1 protein, human
DNAL4
DNAL4 gene
DNALC4, MOUSE, HOMOLOG OF
DNALI1
DNALI1 gene
Dnali1 protein, mouse
DNAM-1
DNAM-1 protein, human
DNAM-1 protein, mouse
DNAM1
242 243 244 245 246